Basic information for AC008543.1-202-10aa-1
| Peptide Name | AC008543.1-202-10aa-1 |
| Genome Position | chr19:11686170-11686199[+] |
| Species | Human |
| Peptide Sequence | MNVKNVVKPV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.23 |
| Relative Molecular Mass | 1289.56 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000197332;AC008543.1 |
| Transcript ID/Name | ENST00000344893;AC008543.1-202 |
| Transcript Length | 3383 |
| Coding Ability | 0.5273 |
| DNA Sequence Corresponding to Peptide | ATGAATGTAAAGAATGTGGTAAAACCTGTG |
|
Conservation
|
|
|