Basic information for AC010198.2-203-10aa
| Peptide Name | AC010198.2-203-10aa |
| Genome Position | chr12:30802748-30802777[+] |
| Species | Human |
| Peptide Sequence | MVYPFWNTII |
| Peptide Length | 10 |
| Unique | No (AC010198.2-205-10aa-3,AC010198.2-206-10aa,AC010198.2-201-10aa,AC010198.2-212-10aa-2) |
| Grand Average of Hydropathicity | 0.99 |
| Relative Molecular Mass | 1445.71 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285517;AC010198.2 |
| Transcript ID/Name | ENST00000648367;AC010198.2-203 |
| Transcript Length | 1402 |
| Coding Ability | 0.306 |
| DNA Sequence Corresponding to Peptide | ATGGTTTATCCTTTCTGGAATACTATTATA |
|
Conservation
|
|
|