Basic information for AC010198.2-205-10aa-2
| Peptide Name | AC010198.2-205-10aa-2 |
| Genome Position | chr12:30811714-30811743[+] |
| Species | Human |
| Peptide Sequence | MIPIYEVRSL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.72 |
| Relative Molecular Mass | 1382.61 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285517;AC010198.2 |
| Transcript ID/Name | ENST00000648050;AC010198.2-205 |
| Transcript Length | 16489 |
| Coding Ability | 0.406 |
| DNA Sequence Corresponding to Peptide | ATGATTCCAATTTATGAAGTTAGATCCTTG |
|
Conservation
|
|
|