Basic information for AC010198.2-212-10aa-1
| Peptide Name | AC010198.2-212-10aa-1 |
| Genome Position | chr12:30806026-30806055[+] |
| Species | Human |
| Peptide Sequence | MNFIRLLKEF |
| Peptide Length | 10 |
| Unique | No (AC010198.2-205-10aa-1) |
| Grand Average of Hydropathicity | 0.42 |
| Relative Molecular Mass | 1472.74 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285517;AC010198.2 |
| Transcript ID/Name | ENST00000650198;AC010198.2-212 |
| Transcript Length | 5367 |
| Coding Ability | 0.4125 |
| DNA Sequence Corresponding to Peptide | ATGAATTTCATTAGATTGTTGAAAGAGTTT |
|
Conservation
|
|
|