Basic information for AC010198.2-213-10aa
| Peptide Name | AC010198.2-213-10aa |
| Genome Position | chr12:30800343-30800372[+] |
| Species | Human |
| Peptide Sequence | MLIGSGTFRT |
| Peptide Length | 10 |
| Unique | No (AC010198.2-210-10aa-2) |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1244.49 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000285517;AC010198.2 |
| Transcript ID/Name | ENST00000551972;AC010198.2-213 |
| Transcript Length | 688 |
| Coding Ability | 0.532 |
| DNA Sequence Corresponding to Peptide | ATGTTGATTGGAAGTGGAACCTTTAGGACA |
m6A
|
Conservation
|
|
|