Basic information for AC010343.3-203-10aa-2
| Peptide Name | AC010343.3-203-10aa-2 |
| Genome Position | chr5:32888463-32888492[-] |
| Species | Human |
| Peptide Sequence | MQETKLLCVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.38 |
| Relative Molecular Mass | 1313.58 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000250697;AC010343.3 |
| Transcript ID/Name | ENST00000666525;AC010343.3-203 |
| Transcript Length | 1150 |
| Coding Ability | 0.2817 |
| DNA Sequence Corresponding to Peptide | ATGCAAGAAACAAAACTTTTATGTGTGTCT |
|
Conservation
|
|
|