Basic information for AC010615.2-202-10aa-1
| Peptide Name | AC010615.2-202-10aa-1 |
| Genome Position | chr19:21448869-21448898[-] |
| Species | Human |
| Peptide Sequence | MILITRANTK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.32 |
| Relative Molecular Mass | 1322.64 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000268119;AC010615.2 |
| Transcript ID/Name | ENST00000597444;AC010615.2-202 |
| Transcript Length | 1916 |
| Coding Ability | 0.4489 |
| DNA Sequence Corresponding to Peptide | ATGATTCTCATCACAAGGGCAAATACAAAG |
m6A
|
Conservation
|
|
|