Basic information for AC010615.2-205-10aa
| Peptide Name | AC010615.2-205-10aa |
| Genome Position | chr19:21452757-21452786[-] |
| Species | Human |
| Peptide Sequence | MICPLQSPKV |
| Peptide Length | 10 |
| Unique | No (AC010615.2-203-10aa,AC010615.2-202-10aa-2,AC010615.2-204-10aa,AC010615.2-208-10aa) |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1277.55 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000268119;AC010615.2 |
| Transcript ID/Name | ENST00000599993;AC010615.2-205 |
| Transcript Length | 1581 |
| Coding Ability | 0.3662 |
| DNA Sequence Corresponding to Peptide | ATGATCTGCCCGCTTCAGTCTCCCAAAGTG |
|
Conservation
|
|
|