Basic information for AC010733.2-201-10aa-1
| Peptide Name | AC010733.2-201-10aa-1 |
| Genome Position | chr2:60926395-60926424[+] |
| Species | Human |
| Peptide Sequence | MSGDCPPCQI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1212.37 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000267520;AC010733.2 |
| Transcript ID/Name | ENST00000589496;AC010733.2-201 |
| Transcript Length | 5702 |
| Coding Ability | 0.4549 |
| DNA Sequence Corresponding to Peptide | ATGAGCGGAGACTGCCCGCCTTGTCAAATC |
|
Conservation
|
|
|