Basic information for AC010733.2-201-10aa-3
| Peptide Name | AC010733.2-201-10aa-3 |
| Genome Position | chr2:60927856-60927885[+] |
| Species | Human |
| Peptide Sequence | MPLPSLYLHL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.86 |
| Relative Molecular Mass | 1345.59 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000267520;AC010733.2 |
| Transcript ID/Name | ENST00000589496;AC010733.2-201 |
| Transcript Length | 5702 |
| Coding Ability | 0.4549 |
| DNA Sequence Corresponding to Peptide | ATGCCCCTTCCCAGTCTGTACCTACACCTC |
m6A
|
Conservation
|
|
|