Basic information for AC011346.1-211-10aa
| Peptide Name | AC011346.1-211-10aa |
| Genome Position | chr5:148378713-148378742[-] |
| Species | Human |
| Peptide Sequence | MCLLPCHLPP |
| Peptide Length | 10 |
| Unique | No (AC011346.1-201-10aa-1,AC011346.1-202-10aa-1,AC011346.1-207-10aa-1,AC011346.1-206-10aa,AC011346.1-213-10aa-1,AC011346.1-203-10aa,AC011346.1-215-10aa-1,AC011346.1-208-10aa-1,AC011346.1-205-10aa-1,AC011346.1-209-10aa,AC011346.1-214-10aa-1) |
| Grand Average of Hydropathicity | 1.03 |
| Relative Molecular Mass | 1285.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247199;AC011346.1 |
| Transcript ID/Name | ENST00000665452;AC011346.1-211 |
| Transcript Length | 1315 |
| Coding Ability | 0.3551 |
| DNA Sequence Corresponding to Peptide | ATGTGCTTGCTTCCTTGTCACCTTCCGCCA |
|
Conservation
|
|
|