Basic information for AC011346.1-212-10aa
| Peptide Name | AC011346.1-212-10aa |
| Genome Position | chr5:148308036-148308065[-] |
| Species | Human |
| Peptide Sequence | MGADFPLLFS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.06 |
| Relative Molecular Mass | 1259.41 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247199;AC011346.1 |
| Transcript ID/Name | ENST00000655946;AC011346.1-212 |
| Transcript Length | 716 |
| Coding Ability | 0.3603 |
| DNA Sequence Corresponding to Peptide | ATGGGGGCAGATTTCCCCTTGCTGTTCTCA |
|
Conservation
|
|
|