Basic information for AC011346.1-213-10aa-2
| Peptide Name | AC011346.1-213-10aa-2 |
| Genome Position | chr5:148330521-148330550[-] |
| Species | Human |
| Peptide Sequence | MRENFCNLLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.43 |
| Relative Molecular Mass | 1414.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000247199;AC011346.1 |
| Transcript ID/Name | ENST00000661718;AC011346.1-213 |
| Transcript Length | 5039 |
| Coding Ability | 0.334 |
| DNA Sequence Corresponding to Peptide | ATGAGAGAAAATTTTTGCAACCTACTCATC |
|
Conservation
|
|
|