Basic information for AC011447.3-207-10aa-1
| Peptide Name | AC011447.3-207-10aa-1 |
| Genome Position | chr19:20125058-20125087[-] |
| Species | Human |
| Peptide Sequence | MNEISFFSLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.64 |
| Relative Molecular Mass | 1336.45 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000267383;AC011447.3 |
| Transcript ID/Name | ENST00000657925;AC011447.3-207 |
| Transcript Length | 4477 |
| Coding Ability | 0.3962 |
| DNA Sequence Corresponding to Peptide | ATGAATGAGATTTCCTTTTTTTCCCTGTCA |
m6A
|
Conservation
|
|
|