Basic information for AC011447.3-208-10aa
| Peptide Name | AC011447.3-208-10aa |
| Genome Position | chr19:20220323-20220342,20301381-20301390[-] |
| Species | Human |
| Peptide Sequence | MVEGLILRKC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1323.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000267383;AC011447.3 |
| Transcript ID/Name | ENST00000670854;AC011447.3-208 |
| Transcript Length | 558 |
| Coding Ability | 0.491 |
| DNA Sequence Corresponding to Peptide | ATGGTGGAAGGCTTAATACTTAGAAAGTGC |
|
Conservation
|
|
|