Basic information for AC011474.1-202-10aa
| Peptide Name | AC011474.1-202-10aa |
| Genome Position | chr19:29412500-29412529[-] |
| Species | Human |
| Peptide Sequence | MKNCLRLGNL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0 |
| Relative Molecular Mass | 1323.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000264515;AC011474.1 |
| Transcript ID/Name | ENST00000577849;AC011474.1-202 |
| Transcript Length | 1127 |
| Coding Ability | 0.4241 |
| DNA Sequence Corresponding to Peptide | ATGAAGAACTGCCTGAGACTGGGTAATTTA |
|
Conservation
|
|
|