Basic information for AC011752.1-202-10aa
| Peptide Name | AC011752.1-202-10aa |
| Genome Position | chr2:21403091-21403120[+] |
| Species | Human |
| Peptide Sequence | MCVSISPANC |
| Peptide Length | 10 |
| Unique | No (AC011752.1-204-10aa,AC011752.1-203-10aa,AC011752.1-207-10aa) |
| Grand Average of Hydropathicity | 1.07 |
| Relative Molecular Mass | 1186.37 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000231204;AC011752.1 |
| Transcript ID/Name | ENST00000649482;AC011752.1-202 |
| Transcript Length | 1061 |
| Coding Ability | 0.6107 |
| DNA Sequence Corresponding to Peptide | ATGTGCGTGTCTATCTCTCCTGCTAACTGC |
|
Conservation
|
|
|