Basic information for AC013652.1-203-10aa
| Peptide Name | AC013652.1-203-10aa |
| Genome Position | chr15:38886815-38886844[-] |
| Species | Human |
| Peptide Sequence | MQISLLWPLT |
| Peptide Length | 10 |
| Unique | No (AC013652.1-201-10aa) |
| Grand Average of Hydropathicity | 1.03 |
| Relative Molecular Mass | 1363.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259345;AC013652.1 |
| Transcript ID/Name | ENST00000560484;AC013652.1-203 |
| Transcript Length | 550 |
| Coding Ability | 0.3036 |
| DNA Sequence Corresponding to Peptide | ATGCAGATTTCTCTTCTCTGGCCATTGACA |
|
Conservation
|
|
|