Basic information for AC013652.1-206-10aa
| Peptide Name | AC013652.1-206-10aa |
| Genome Position | chr15:39189247-39189276[-] |
| Species | Human |
| Peptide Sequence | MHSRCSINFI |
| Peptide Length | 10 |
| Unique | No (AC013652.1-209-10aa) |
| Grand Average of Hydropathicity | 0.34 |
| Relative Molecular Mass | 1369.56 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259345;AC013652.1 |
| Transcript ID/Name | ENST00000560743;AC013652.1-206 |
| Transcript Length | 1961 |
| Coding Ability | 0.4513 |
| DNA Sequence Corresponding to Peptide | ATGCATAGTAGGTGCTCAATAAATTTCATC |
|
Conservation
|
|
|