Basic information for AC018362.1-201-10aa-2
| Peptide Name | AC018362.1-201-10aa-2 |
| Genome Position | chr15:42531193-42531222[-] |
| Species | Human |
| Peptide Sequence | MAVFGNASKS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.31 |
| Relative Molecular Mass | 1173.29 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000261684;AC018362.1 |
| Transcript ID/Name | ENST00000649053;AC018362.1-201 |
| Transcript Length | 2768 |
| Coding Ability | 0.3764 |
| DNA Sequence Corresponding to Peptide | ATGGCTGTCTTTGGCAATGCTTCCAAATCT |
|
Conservation
|
|
|