Basic information for AC019197.1-203-10aa-1
| Peptide Name | AC019197.1-203-10aa-1 |
| Genome Position | chr2:165081467-165081496[+] |
| Species | Human |
| Peptide Sequence | MLSKHFLWFL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.01 |
| Relative Molecular Mass | 1483.76 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236283;AC019197.1 |
| Transcript ID/Name | ENST00000414885;AC019197.1-203 |
| Transcript Length | 2639 |
| Coding Ability | 0.3623 |
| DNA Sequence Corresponding to Peptide | ATGCTAAGTAAGCATTTTTTGTGGTTTCTT |
|
Conservation
|
|
|