Basic information for AC019197.1-210-10aa
| Peptide Name | AC019197.1-210-10aa |
| Genome Position | chr2:164960679-164960708[+] |
| Species | Human |
| Peptide Sequence | MSQSLLGSLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.08 |
| Relative Molecular Mass | 1210.38 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236283;AC019197.1 |
| Transcript ID/Name | ENST00000671488;AC019197.1-210 |
| Transcript Length | 1650 |
| Coding Ability | 0.1927 |
| DNA Sequence Corresponding to Peptide | ATGTCTCAATCTTTGTTGGGAAGTCTTCTC |
|
Conservation
|
|
|