Basic information for AC019197.1-213-10aa
| Peptide Name | AC019197.1-213-10aa |
| Genome Position | chr2:165194967-165194996[+] |
| Species | Human |
| Peptide Sequence | MPLTAAGNAE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.14 |
| Relative Molecular Mass | 1136.26 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000236283;AC019197.1 |
| Transcript ID/Name | ENST00000629817;AC019197.1-213 |
| Transcript Length | 980 |
| Coding Ability | 0.6082 |
| DNA Sequence Corresponding to Peptide | ATGCCACTTACTGCAGCGGGGAATGCAGAG |
|
Conservation
|
|
|