Basic information for AC026495.2-201-10aa
| Peptide Name | AC026495.2-201-10aa |
| Genome Position | chr15:20331530-20331559[+] |
| Species | Human |
| Peptide Sequence | MSQFISSAIQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.61 |
| Relative Molecular Mass | 1273.4 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287122;AC026495.2 |
| Transcript ID/Name | ENST00000656782;AC026495.2-201 |
| Transcript Length | 1376 |
| Coding Ability | 0.3401 |
| DNA Sequence Corresponding to Peptide | ATGAGCCAGTTTATATCATCAGCTATTCAA |
|
Conservation
|
|
|