Basic information for AC060234.2-201-10aa-2
| Peptide Name | AC060234.2-201-10aa-2 |
| Genome Position | chr10:48979747-48979776[-] |
| Species | Human |
| Peptide Sequence | MALPESTEWL |
| Peptide Length | 10 |
| Unique | No (AC060234.2-202-10aa) |
| Grand Average of Hydropathicity | 0.03 |
| Relative Molecular Mass | 1338.5 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000233665;AC060234.2 |
| Transcript ID/Name | ENST00000428825;AC060234.2-201 |
| Transcript Length | 1610 |
| Coding Ability | 0.605 |
| DNA Sequence Corresponding to Peptide | ATGGCACTGCCAGAATCAACTGAATGGCTC |
m6A
|
Conservation
|
|
|