Basic information for AC068205.2-204-10aa-1
| Peptide Name | AC068205.2-204-10aa-1 |
| Genome Position | chr11:43644539-43644568[+] |
| Species | Human |
| Peptide Sequence | MGLCFLCCGL |
| Peptide Length | 10 |
| Unique | No (AC068205.2-202-10aa-2) |
| Grand Average of Hydropathicity | 2.28 |
| Relative Molecular Mass | 1221.53 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000283341;AC068205.2 |
| Transcript ID/Name | ENST00000664853;AC068205.2-204 |
| Transcript Length | 2814 |
| Coding Ability | 0.3603 |
| DNA Sequence Corresponding to Peptide | ATGGGGTTGTGCTTTCTGTGTTGTGGTTTG |
|
Conservation
|
|
|