Basic information for AC068308.1-201-10aa
| Peptide Name | AC068308.1-201-10aa |
| Genome Position | chr3:181373220-181373249[-] |
| Species | Human |
| Peptide Sequence | MRILKFCFSL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.29 |
| Relative Molecular Mass | 1419.74 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241231;AC068308.1 |
| Transcript ID/Name | ENST00000663941;AC068308.1-201 |
| Transcript Length | 1757 |
| Coding Ability | 0.288 |
| DNA Sequence Corresponding to Peptide | ATGAGAATTTTAAAATTCTGCTTTTCATTA |
|
Conservation
|
|
|