Basic information for AC068308.1-205-10aa-2
| Peptide Name | AC068308.1-205-10aa-2 |
| Genome Position | chr3:181417434-181417463[-] |
| Species | Human |
| Peptide Sequence | MYIFTVVKNP |
| Peptide Length | 10 |
| Unique | No (AC068308.1-211-10aa,AC068308.1-210-10aa,AC068308.1-208-10aa,AC068308.1-209-10aa-2,AC068308.1-206-10aa-2) |
| Grand Average of Hydropathicity | 0.66 |
| Relative Molecular Mass | 1373.66 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000241231;AC068308.1 |
| Transcript ID/Name | ENST00000671626;AC068308.1-205 |
| Transcript Length | 4899 |
| Coding Ability | 0.3809 |
| DNA Sequence Corresponding to Peptide | ATGTATATTTTCACTGTAGTAAAAAATCCC |
|
Conservation
|
|
|