Basic information for AC068587.4-201-10aa
| Peptide Name | AC068587.4-201-10aa |
| Genome Position | chr8:12469925-12469954[-] |
| Species | Human |
| Peptide Sequence | MAHCSLNLLG |
| Peptide Length | 10 |
| Unique | No (AC105233.5-202-10aa) |
| Grand Average of Hydropathicity | 0.97 |
| Relative Molecular Mass | 1220.41 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000283674;AC068587.4 |
| Transcript ID/Name | ENST00000641618;AC068587.4-201 |
| Transcript Length | 4514 |
| Coding Ability | 0.4001 |
| DNA Sequence Corresponding to Peptide | ATGGCTCACTGCAGCCTCAACCTCCTGGGC |
|
Conservation
|
|
|