Basic information for AC068587.4-202-10aa-1
| Peptide Name | AC068587.4-202-10aa-1 |
| Genome Position | chr8:12485788-12485817[-] |
| Species | Human |
| Peptide Sequence | MLVQPLIVKS |
| Peptide Length | 10 |
| Unique | No (AC010329.1-201-10aa-3,AC105233.5-203-10aa-1,AC105233.5-201-10aa-1,AC092745.4-201-10aa-1,AC127526.5-201-10aa) |
| Grand Average of Hydropathicity | 1.26 |
| Relative Molecular Mass | 1289.58 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000283674;AC068587.4 |
| Transcript ID/Name | ENST00000660816;AC068587.4-202 |
| Transcript Length | 3013 |
| Coding Ability | 0.3508 |
| DNA Sequence Corresponding to Peptide | ATGCTTGTGCAGCCATTAATAGTAAAAAGC |
|
Conservation
|
|
|