Basic information for AC068587.4-204-10aa
| Peptide Name | AC068587.4-204-10aa |
| Genome Position | chr8:12537236-12537265[-] |
| Species | Human |
| Peptide Sequence | MGLLSAWIPE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.86 |
| Relative Molecular Mass | 1278.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000283674;AC068587.4 |
| Transcript ID/Name | ENST00000635775;AC068587.4-204 |
| Transcript Length | 3959 |
| Coding Ability | 0.4925 |
| DNA Sequence Corresponding to Peptide | ATGGGGCTTTTGTCAGCCTGGATCCCTGAG |
|
Conservation
|
|
|