Basic information for AC068672.2-203-10aa
| Peptide Name | AC068672.2-203-10aa |
| Genome Position | chr8:31384691-31384720[+] |
| Species | Human |
| Peptide Sequence | MASLLNFIRH |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.66 |
| Relative Molecular Mass | 1363.57 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000253377;AC068672.2 |
| Transcript ID/Name | ENST00000655813;AC068672.2-203 |
| Transcript Length | 1666 |
| Coding Ability | 0.3385 |
| DNA Sequence Corresponding to Peptide | ATGGCATCACTGCTGAATTTTATCAGACAT |
|
Conservation
|
|
|