Basic information for AC073130.2-202-10aa
| Peptide Name | AC073130.2-202-10aa |
| Genome Position | chr7:116243872-116243901[-] |
| Species | Human |
| Peptide Sequence | MCLLPLLPQL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.67 |
| Relative Molecular Mass | 1302.63 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000243243;AC073130.2 |
| Transcript ID/Name | ENST00000444244;AC073130.2-202 |
| Transcript Length | 842 |
| Coding Ability | 0.4501 |
| DNA Sequence Corresponding to Peptide | ATGTGTTTGCTTCCTCTTTTGCCACAATTG |
m6A
|
Conservation
|
|
|