Basic information for AC073225.1-202-10aa-5
| Peptide Name | AC073225.1-202-10aa-5 |
| Genome Position | chr2:155560726-155560755[+] |
| Species | Human |
| Peptide Sequence | MTGSQFRFLA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.32 |
| Relative Molecular Mass | 1319.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286679;AC073225.1 |
| Transcript ID/Name | ENST00000662301;AC073225.1-202 |
| Transcript Length | 6460 |
| Coding Ability | 0.326 |
| DNA Sequence Corresponding to Peptide | ATGACAGGAAGCCAATTCAGGTTTTTGGCA |
|
Conservation
|
|
|