Basic information for AC074051.5-201-10aa
| Peptide Name | AC074051.5-201-10aa |
| Genome Position | chr16:5235638-5235667[+] |
| Species | Human |
| Peptide Sequence | MPTLLKVLGN |
| Peptide Length | 10 |
| Unique | No (AC074051.5-203-10aa) |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1247.54 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285567;AC074051.5 |
| Transcript ID/Name | ENST00000650622;AC074051.5-201 |
| Transcript Length | 943 |
| Coding Ability | 0.3606 |
| DNA Sequence Corresponding to Peptide | ATGCCCACTTTGTTGAAAGTACTTGGAAAT |
|
Conservation
|
|
|