Basic information for AC074091.2-201-10aa
| Peptide Name | AC074091.2-201-10aa |
| Genome Position | chr2:27583113-27583142[+] |
| Species | Human |
| Peptide Sequence | MSSRLGAVPA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.54 |
| Relative Molecular Mass | 1150.29 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSG00000259080;AC074091.2 |
| Transcript ID/Name | ENST00000505973;AC074091.2-201 |
| Transcript Length | 1741 |
| Coding Ability | 0.3716 |
| DNA Sequence Corresponding to Peptide | ATGTCTTCCAGACTCGGTGCTGTACCCGCC |
m6A
|
Conservation
|
|
|