Basic information for AC077690.1-202-10aa
| Peptide Name | AC077690.1-202-10aa |
| Genome Position | chr3:7610503-7610532[-] |
| Species | Human |
| Peptide Sequence | MFSLTTSCWL |
| Peptide Length | 10 |
| Unique | No (AC077690.1-201-10aa) |
| Grand Average of Hydropathicity | 1.09 |
| Relative Molecular Mass | 1350.62 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000270207;AC077690.1 |
| Transcript ID/Name | ENST00000652500;AC077690.1-202 |
| Transcript Length | 932 |
| Coding Ability | 0.3058 |
| DNA Sequence Corresponding to Peptide | ATGTTTTCGCTAACCACATCCTGTTGGTTG |
|
Conservation
|
|
|