Basic information for AC080079.2-201-10aa-2
| Peptide Name | AC080079.2-201-10aa-2 |
| Genome Position | chr4:165648821-165648850[-] |
| Species | Human |
| Peptide Sequence | MLYHHKFLKI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.13 |
| Relative Molecular Mass | 1491.8 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287424;AC080079.2 |
| Transcript ID/Name | ENST00000668379;AC080079.2-201 |
| Transcript Length | 1884 |
| Coding Ability | 0.5499 |
| DNA Sequence Corresponding to Peptide | ATGCTTTATCACCACAAATTTTTAAAAATT |
|
Conservation
|
|
|