Basic information for AC080079.2-202-10aa-1
| Peptide Name | AC080079.2-202-10aa-1 |
| Genome Position | chr4:165727332-165727361[-] |
| Species | Human |
| Peptide Sequence | MLRSILSLHG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.81 |
| Relative Molecular Mass | 1288.5 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287424;AC080079.2 |
| Transcript ID/Name | ENST00000657783;AC080079.2-202 |
| Transcript Length | 8619 |
| Coding Ability | 0.36 |
| DNA Sequence Corresponding to Peptide | ATGTTAAGATCCATTTTGAGCCTCCACGGA |
|
Conservation
|
|
|