Basic information for AC083837.1-201-10aa-1
| Peptide Name | AC083837.1-201-10aa-1 |
| Genome Position | chr8:78939751-78939780[+] |
| Species | Human |
| Peptide Sequence | MLPAKSHLEL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.21 |
| Relative Molecular Mass | 1300.51 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000285744;AC083837.1 |
| Transcript ID/Name | ENST00000649603;AC083837.1-201 |
| Transcript Length | 2921 |
| Coding Ability | 0.4026 |
| DNA Sequence Corresponding to Peptide | ATGTTGCCAGCCAAATCTCATCTTGAACTG |
|
Conservation
|
|
|