Basic information for AC087473.1-204-10aa
| Peptide Name | AC087473.1-204-10aa |
| Genome Position | chr15:38221964-38221993[-] |
| Species | Human |
| Peptide Sequence | MSGTCAFSTQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.21 |
| Relative Molecular Mass | 1194.37 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000259380;AC087473.1 |
| Transcript ID/Name | ENST00000656912;AC087473.1-204 |
| Transcript Length | 2751 |
| Coding Ability | 0.3817 |
| DNA Sequence Corresponding to Peptide | ATGTCTGGAACTTGTGCTTTTAGCACTCAA |
|
Conservation
|
|
|