Basic information for AC087854.1-201-10aa-2
| Peptide Name | AC087854.1-201-10aa-2 |
| Genome Position | chr8:22541802-22541831[-] |
| Species | Human |
| Peptide Sequence | MPLLVTKVSP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.93 |
| Relative Molecular Mass | 1246.55 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251034;AC087854.1 |
| Transcript ID/Name | ENST00000514980;AC087854.1-201 |
| Transcript Length | 4076 |
| Coding Ability | 0.4127 |
| DNA Sequence Corresponding to Peptide | ATGCCTCTACTTGTAACCAAAGTGTCACCT |
|
Conservation
|
|
|