Basic information for AC087854.1-203-10aa
| Peptide Name | AC087854.1-203-10aa |
| Genome Position | chr8:22481843-22481872[-] |
| Species | Human |
| Peptide Sequence | MGENFCNLSI |
| Peptide Length | 10 |
| Unique | No (AP001033.1-201-10aa,AL590068.3-201-10aa,AC025164.2-201-10aa,AC087854.1-204-10aa,AC104232.3-201-10aa,AP000787.1-211-10aa,AP000787.1-212-10aa) |
| Grand Average of Hydropathicity | 0.38 |
| Relative Molecular Mass | 1289.43 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000251034;AC087854.1 |
| Transcript ID/Name | ENST00000668235;AC087854.1-203 |
| Transcript Length | 1621 |
| Coding Ability | 0.4762 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTTTTGCAATCTATCCATC |
|
Conservation
|
|
|