Basic information for AC090114.2-201-10aa-3
| Peptide Name | AC090114.2-201-10aa-3 |
| Genome Position | chr7:128529228-128529257[-] |
| Species | Human |
| Peptide Sequence | MVIIIVPSHR |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.37 |
| Relative Molecular Mass | 1326.6 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000273270;AC090114.2 |
| Transcript ID/Name | ENST00000608477;AC090114.2-201 |
| Transcript Length | 7054 |
| Coding Ability | 0.4481 |
| DNA Sequence Corresponding to Peptide | ATGGTCATCATCATTGTTCCAAGCCATAGA |
|
Conservation
|
|
|