Basic information for AC090825.1-217-10aa
| Peptide Name | AC090825.1-217-10aa |
| Genome Position | chr15:99883311-99883340[+] |
| Species | Human |
| Peptide Sequence | MGENCCNLLI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.81 |
| Relative Molecular Mass | 1271.48 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000259363;AC090825.1 |
| Transcript ID/Name | ENST00000670236;AC090825.1-217 |
| Transcript Length | 1819 |
| Coding Ability | 0.4898 |
| DNA Sequence Corresponding to Peptide | ATGGGAGAAAATTGTTGTAATCTACTCATC |
m6A
|
Conservation
|
|
|