Basic information for AC091167.5-201-10aa
| Peptide Name | AC091167.5-201-10aa |
| Genome Position | chr15:90282017-90282046[+] |
| Species | Human |
| Peptide Sequence | MLQLESKASC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.13 |
| Relative Molecular Mass | 1271.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000275345;AC091167.5 |
| Transcript ID/Name | ENST00000610689;AC091167.5-201 |
| Transcript Length | 413 |
| Coding Ability | 0.5521 |
| DNA Sequence Corresponding to Peptide | ATGCTGCAGCTGGAATCAAAGGCAAGCTGT |
|
Conservation
|
|
|