Basic information for AC092053.4-201-10aa
| Peptide Name | AC092053.4-201-10aa |
| Genome Position | chr3:39178982-39179011[+] |
| Species | Human |
| Peptide Sequence | MADAATPLGK |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.1 |
| Relative Molecular Mass | 1136.3 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287620;AC092053.4 |
| Transcript ID/Name | ENST00000669199;AC092053.4-201 |
| Transcript Length | 1251 |
| Coding Ability | 0.2078 |
| DNA Sequence Corresponding to Peptide | ATGGCAGATGCTGCTACCCCTCTTGGAAAA |
|
Conservation
|
|
|