Basic information for AC092078.3-201-10aa-1
| Peptide Name | AC092078.3-201-10aa-1 |
| Genome Position | chr15:47960520-47960549[-] |
| Species | Human |
| Peptide Sequence | MDALKKLCLS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.55 |
| Relative Molecular Mass | 1283.54 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000287439;AC092078.3 |
| Transcript ID/Name | ENST00000657831;AC092078.3-201 |
| Transcript Length | 4022 |
| Coding Ability | 0.5015 |
| DNA Sequence Corresponding to Peptide | ATGGATGCATTGAAGAAGCTATGCTTGAGC |
|
Conservation
|
|
|