Basic information for AC092445.1-201-10aa-1
| Peptide Name | AC092445.1-201-10aa-1 |
| Genome Position | chr4:106935773-106935802[+] |
| Species | Human |
| Peptide Sequence | MGRLPPQVGL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.17 |
| Relative Molecular Mass | 1229.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000286147;AC092445.1 |
| Transcript ID/Name | ENST00000650850;AC092445.1-201 |
| Transcript Length | 4893 |
| Coding Ability | 0.3848 |
| DNA Sequence Corresponding to Peptide | ATGGGCAGACTGCCTCCTCAAGTGGGTCTC |
|
Conservation
|
|
|