Basic information for AC092807.3-203-10aa
| Peptide Name | AC092807.3-203-10aa |
| Genome Position | chr1:85494295-85494324[-] |
| Species | Human |
| Peptide Sequence | MGNVGKQGLV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.2 |
| Relative Molecular Mass | 1164.35 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSG00000282057;AC092807.3 |
| Transcript ID/Name | ENST00000467530;AC092807.3-203 |
| Transcript Length | 2745 |
| Coding Ability | 0.3931 |
| DNA Sequence Corresponding to Peptide | ATGGGAAATGTGGGAAAACAGGGGCTAGTC |
m6A
|
Conservation
|
|
|